1
$\begingroup$

I have a DNA sequence dataset each mapped to a certain class. e,g

TCAGCCGAGAGCTCATCGATCGTACGT 2

ATGCAGTGCATCGATCGATCGTAGAAC 3

Where the number after the sequence specifies the type of protein this sequence belongs to.

So my question can I use KMers and 1-HOT-Coding to classify these sequences through biLSTM.

Or this is not a possible concept and I would appreciate your feedback and suggestions on this task as I am new to Deep Learning.

Thank you.

$\endgroup$

0

Your Answer

By clicking “Post Your Answer”, you agree to our terms of service and acknowledge that you have read and understand our privacy policy and code of conduct.