Skip to main content

Questions tagged [gru]

The tag has no usage guidance.

Filter by
Sorted by
Tagged with
0 votes
0 answers
12 views

i am facing problem in combining the forecasts generated by multiple stacked GRU models

first i have used CEEMDAN, to decompose multi-variate data into different IMFs, after that for each IMF stacked GRU model is trained, which gives results for each IMFs, for the final predictions i ...
Poonam Dhaka's user avatar
1 vote
1 answer
34 views

Aside from trial and error, how do I select the number of layers and unit counts for LSTMS, GRUs, and Transformer units for text and time series?

When deciding on the number of units and layers for text processing or time-series prediction I rely heavily on trial and error. First, I look for a reference or paper on the topic such as the white ...
Joachim Rives's user avatar
0 votes
0 answers
14 views

Lack of Variability in Predictions from Multivariate LSTM Model

I've been working on a multivariate LSTM model for time series forecasting, but I'm encountering an issue where the predicted output doesn't exhibit enough variability. The predictions tend to be too ...
Pavol Krajkovič's user avatar
0 votes
0 answers
44 views

Improving Wake-Word Detection Model Performance: Seeking Advice and Suggestions

I was assigned a task to train a wake-word detection model. Basically, it's a binary sequence classification model on audio samples where it should be 1 if it recognizes the wake word being said (e.g. ...
Ícaro Lorran's user avatar
0 votes
0 answers
17 views

Sending rolling statistics to RNN

I'm curious if anyone has seen cases where sending rolling statistics such as mean, median, min, max, standard deviation, skewness, kurtosis, etc. have been helpful for model accuracy? If so please ...
noNameTed's user avatar
0 votes
0 answers
21 views

Finding a template RNN for time series analysis

I would like to create a RNN, that uses one (A) or several time series (with the same length, A, B, C...) as an input and creates another time series (Z) as an output from that . Basically all time ...
xlaub's user avatar
  • 1
0 votes
0 answers
17 views

Use unclassified texts to improve BERT and RNN GRUN token classification model

I have a training (gold) labelled dataset than consists of 10000 sentences. The task is to create a model that classifies correctly unseen data with B-I-O tags. I have used a BERT and a GRU RNN model. ...
Spyros Triantsfyllou's user avatar
0 votes
0 answers
42 views

GRU as a Classifier

Hello Data Scientists, I have sensor data dataset consists of (10 features and labels), the labels classify the data to (normal or 4 type of attacks). The Label is encoded (0,1,2,3,4). There is a ...
Sarah 's user avatar
0 votes
1 answer
538 views

How can I convert a numpy array of tensors to tensor of tensors?

It is my first GRU model so pardon the stupidity. I am trying to learn by training a simple GRU network on variable length sequences. The sequences are numpy arrays of tensors. The length of numpy ...
Ayush Gupta's user avatar
0 votes
0 answers
11 views

Is this GRU learning good?

Result seems to be a little out of "expected" values. It's timeseries dataset.
Paul Paku's user avatar
  • 101
1 vote
1 answer
742 views

Why are the hidden states of an RNN initialised every epoch instead of every batch?

Why are the hidden states of RNNs/LSTMs/GRUs generally re-initialised only once an epoch has finished, not once a batch has finished?
postnubilaphoebus's user avatar
2 votes
0 answers
95 views

TF: What is the difference between the 'kernel weights' and the 'recurrent kernel weights' in LSTMs/GRUs?

Context: I am trying to understand the differences between the GRU/LSTM cells from tensorflow and pytorch (for research reproducibility) and noticed that TensorFlow differentiates between the ...
Robin van Hoorn's user avatar
1 vote
0 answers
41 views

RNN to model DNA sequencing classification

I have a DNA sequence dataset each mapped to a certain class. e,g TCAGCCGAGAGCTCATCGATCGTACGT 2 ATGCAGTGCATCGATCGATCGTAGAAC 3 Where the number after the sequence specifies the type of protein this ...
Juliet Soujbel's user avatar
0 votes
3 answers
271 views

Converting a speech recognition model from CNNs to GRUs

I am trying to convert the simple audio recognition example from TensorFlow to use GRUs instead of CNNs. The idea is to classify an audio clip onto a set of 8 labels: ...
M-V's user avatar
  • 101
0 votes
1 answer
491 views

How is the hidden state of a GRU initialized

This is a GRU. Now, what will be the value of $h_t$, at $t$=$0$. That is, what will be the value of the hidden state at just the starting?
Batman's user avatar
  • 1
0 votes
1 answer
509 views

Why is the variance of my model predictions much smaller than the training data?

I trained a GRU model on some data and then created a bunch of predictions on a test set. The predictions are really bad, as indicated by a near zero R2 score. I notice that the variance of the model ...
eartoolbox's user avatar
0 votes
1 answer
75 views

LSTM / GRU weights during test time

I am working on a historic time series dataset and using RNN, LSTM, GRU models, and I didn't find an answer if in test time, the h (or h, c) weights should be zeors for each batch? If the weights ...
Yuval Asher's user avatar
2 votes
1 answer
47 views

GRU and LSTM does not "take risk" predicting

I tested LSTM and GRU models to predict the exchange rate between currencies. I do not take the raw price but a the delta with the previous day, so the data is stationnary around zero. My problem is ...
alarty's user avatar
  • 21
2 votes
0 answers
270 views

Custom GRU With 3D Spatial Convolution Layer In Keras

I am trying to implement a custom GRU model that is shown in this paper 3D-R2N2 The GRU pipeline looks like: The original implementation is theano based and I am trying to apply the model in tf2/...
b15h0y's user avatar
  • 21
1 vote
1 answer
1k views

How to add a Decoder & Attention Layer to Bidirectional Encoder with tensorflow 2.0

I am a beginner in machine learning and I'm trying to create a spelling correction model that spell checks for a small amount of vocab (approximately 1000 phrases). Currently, I am refering to the ...
Dom's user avatar
  • 11
1 vote
0 answers
92 views

LSTM / GRU prediction with hidden state?

I am trying to predict a value based on time series by series of 24 periods (the 25th period) While training I have a validation set with I babysit the training (RMSE) and each epoch, eval the ...
Yuval Asher's user avatar
1 vote
1 answer
337 views

Using GRU with FeedForward layers in Python

I'm trying to reproduce the codes in this paper here for the multi-labeling problem (11 classes), which is using ...
Zahra Hnn's user avatar
1 vote
1 answer
319 views

Keras RNN (batch_size

I created an RNN model for text classification with the LSTM layer, but when I put the batch_size in the fit method, my model trained on the whole batch instead of just the mini-batch _size. This also ...
cho_uc's user avatar
  • 38
8 votes
1 answer
7k views

TensorFlow / Keras: What is stateful = True in LSTM layers?

Could you elaborate on this argument? I found the brief explanation from the docs unsatisfying: stateful: Boolean (default False). If True, the last state for each sample at index i in a batch will ...
Leevo's user avatar
  • 6,265
2 votes
1 answer
619 views

Impact of varying sequence length in ensemble GRU model

I am using ensemble gru for my project and keeping different cell sizes for different models !For example, first gru model is of size 16 and the second is of 8 and 4 for the third model. The model is ...
Mogambo0001's user avatar
2 votes
0 answers
41 views

Wiggle in the initial part of an LSTM prediction

I working on using LSTMs and GRUs to make time series predictions. For the most part the predictions are pretty good. However, there seems to be a wiggle (or initial up-then-down) before the ...
AGirlHasNoUsername's user avatar
2 votes
0 answers
62 views

GRU learns small-scale features, but misses large scales

Playing around with weather data, I have set up a simple RNN with one layer of GRUs. It is trained to recover the temperature of the next day, given weather data of the last 5 days, each with 1-hour ...
rugermini's user avatar
181 votes
6 answers
184k views

When to use GRU over LSTM?

The key difference between a GRU and an LSTM is that a GRU has two gates (reset and update gates) whereas an LSTM has three gates (namely input, output and forget gates). Why do we make use of GRU ...
Sayali Sonawane's user avatar